STI Innowacyjne Technologie Laboratoryjne Choose the language:
English Version  Wersja polska
SEARCH
  Homepage » Catalog
Submit to our newsletter:

Submit
  • Suppliers
TrueORF(R) cDNA clones PROMO   Date: Friday 20 April, 2012

OriGene Technologies, Inc.

LentiORF particles available

  • Coverage: Genome-wide, Human, Mouse & Rat
  • Ready-to-use: Just add to cells and get gene expression
  • Broad spectrum: transduce dividing, non-dividing and in vivo
  • Biosafety: replication deficient 3rd generation

TrueORF cDNA clones are tagged ORF clones in mammalian expression vectors

  • Genome wide coverage for human, mouse and rat
  • Two types of tags: Myc-DDK tagged or GFP tagged
  • New: Lenti options are now available.
  • 20,000 Human clones are validated for protein expression
  • 70 destination vectors for additional applications
  • Clone collections available

 

The same ORF inserts are available in 4 different expression vectors

 

pCMV6-Entry

pCMV6-AC-GFP

pLenti-C-Myc-DDK

pLenti-C-mGFP

Vector SKU

PS100001

PS100010

PS100064

PS100071

Vector Map

       

Fusion Tag

C-terminal Myc-DDK

C-terminal tGFP

C-terminal Myc-DDK

C-terminal mGFP

Ideal For

Detection and pufirication of over-expressed protein

Tracking the over-expressed protein in tranfected cells

In hard-to-transfect cells: Detection and purification of over-expressed protein

Tracking the over-expressed protein in tranfected cells


Technical features of TrueORF:

  • The CMV promoter and a Kozak consensus sequence drive protein expression in mammalian cells.
  • The C-terminus of the ORF is tagged with Myc/DDK* or tGFP.
  • Ten (10) ug of purified plasmid is provided for immediate transfection and expression experiments.
  • The upstream T7 promoter allows protein expression in cell-free system.
  • Engineered as the entry vector for the OriGene PrecisionShuttle system.

Each TrueORF Clone is provided with a pair of sequencing primers:

Primer name

Primer sequence (for sequencing)

VP1.5 (forward)

5' GGACTTTCCAAAATGTCG 3'

XL39 (reverse)

5' ATTAGGACAAGGCTGGTGGG 3'

LentiORF Advantages

Continue

Copyright © 2012 STI
Created by eCommerce4u.biz